The Genome Browser is a professional interactive visualization tool for exploring genomic sequences with comprehensive annotation capabilities. This tool provides a powerful interface similar to industry-standard genome browsers (IGV, UCSC Genome Browser) optimized for web-based use.
Key capabilities
- **Interactive sequence visualization**: Navigate and explore genomic sequences with zoom and pan controls - **Color-coded nucleotide display**: Visual representation of DNA sequences with distinct colors for each base - **Annotation tracks**: Display genes, features, and variants as overlapping tracks - **Coordinate navigation**: Jump to specific genomic coordinates instantly - **Professional visualization**: Clean, publication-quality graphics with export capabilities
What is a genome browser?** A genome browser is an essential tool in genomics that provides a graphical interface for: - Viewing DNA sequences at different scales (from single nucleotides to entire chromosomes) - Overlaying multiple types of genomic annotations - Exploring gene structure, regulatory elements, and variations - Analyzing sequence relationships and patterns - Communicating genomic findings through visual representations
Track types
- **Sequence track**: Shows the actual DNA sequence with color-coded nucleotides - **Annotation track**: Displays genomic features like genes, exons, promoters, and variants - **Coordinate ruler**: Provides position references for navigation
Use cases
- Genomic sequence exploration and analysis - Gene structure visualization - Variant visualization and interpretation - Sequence annotation review - Educational and presentation purposes - Research publication graphics
Supported formats
- Raw DNA sequence (A, T, G, C characters) - FASTA format (with or without header) - Sequences of any length (optimized for sequences 100-10,000+ nucleotides)
Sequence requirements
- Must contain only valid DNA nucleotide characters: A, T, G, C - Case insensitive (automatically converted to uppercase) - Ambiguity codes (N) are accepted and displayed - Recommended minimum: 100 nucleotides for meaningful visualization - No maximum length limit (handles large sequences efficiently)
Optional annotations
You can provide annotation data in JSON format: ```json [ { "name": "Gene1", "start": 100, "end": 500, "strand": "+", "feature_type": "gene", "description": "Hypothetical protein" }, { "name": "Promoter1", "start": 50, "end": 100, "strand": "+", "feature_type": "promoter", "description": "RNA polymerase binding site" } ] ```
Annotation fields
- **name**: Feature name or identifier (required) - **start**: Start position (1-based coordinate, required) - **end**: End position (1-based coordinate, required) - **strand**: "+" for forward strand, "-" for reverse strand (required) - **feature_type**: Type of feature (gene, CDS, promoter, variant, exon, intron, etc.) - **description**: Optional description or additional information
View region (optional)
- **Region start**: Starting position to display (default: beginning of sequence) - **Region end**: Ending position to display (default: end of sequence) - Allows focusing on specific regions of long sequences
Example input
``` ATGGCGACCTGTTCAGGACGACGGTGCTGGCCGTGGGGGCCCAGGGCAGAGACACGGGCGCCATGGCCATGGAGAGC ```
For sequences with annotations, use the annotation API or provide annotation data separately.
Interactive Controls
1. **Zoom Controls**: - **Zoom In**: Increase magnification (up to 1000%) - **Zoom Out**: Decrease magnification (down to 10%) - **Zoom Indicator**: Shows current zoom level as percentage - **Automatic scaling**: Sequence bases adjust size with zoom level - **Optimal viewing**: Different zoom levels reveal different levels of detail
2. **Pan Navigation**: - **Pan Left/Right buttons**: Move view along the sequence - **Drag to pan**: Click and drag the visualization area to pan - **Smooth scrolling**: Continuous navigation through long sequences - **Boundary handling**: Prevents panning beyond sequence boundaries
3. **Coordinate Navigation**: - **Jump to position**: Enter a coordinate and jump directly to that position - **Coordinate ruler**: Visual ruler showing position markers at regular intervals - **Position display**: Current view coordinates displayed in header - **Formatted coordinates**: Large numbers formatted with commas for readability
4. **View Controls**: - **Reset view**: Return to default view showing entire sequence - **Annotation toggle**: Show/hide annotation tracks - **Track management**: Individual tracks can be toggled on/off - **Full view**: Optimized for sequences of all sizes
Color Coding
Nucleotides are color-coded for easy identification: - **Adenine (A)**: Red (#ef4444) - **Thymine (T)**: Blue (#3b82f6) - **Guanine (G)**: Green (#22c55e) - **Cytosine (C)**: Orange (#f59e0b) - **Ambiguity (N)**: Gray (#9ca3af)
Annotation Display
- **Feature boxes**: Annotations displayed as colored rectangles - **Strand indicators**: Arrows show direction (forward/reverse strand) - **Color by type**: Different feature types have distinct colors - Genes: Purple - CDS (Coding sequences): Cyan - Promoters: Orange - Variants: Red - Exons: Green - Introns: Blue - **Feature labels**: Annotation names displayed when space allows - **Overlapping features**: Multiple annotations can be displayed simultaneously
Visualization Output
The genome browser provides a professional graphical representation:
Coordinate Ruler
- Position markers at regular intervals - Formatted coordinate labels (e.g., 1,000 instead of 1000) - Ruler spans the visible sequence region - Updates dynamically with zoom and pan
Sequence Track
- Color-coded nucleotide sequence - Base labels visible at appropriate zoom levels - Sequence displayed in readable blocks - Optimized for viewing at various scales
Annotation Track
- Feature boxes positioned accurately by coordinates - Strand direction indicated by arrows - Feature types distinguished by color - Labels displayed for identifiable features - Multiple features can overlap
Information Display
- Current view coordinates (start and end positions) - Total sequence length - Number of visible annotations - Zoom level indicator
Export Options
- **SVG Export**: High-quality vector graphics for publications - Scalable to any size without quality loss - Perfect for presentations and papers - Can be edited in vector graphics software - Includes all tracks and annotations
Export Usage
1. Click "Export SVG" button 2. SVG file downloads automatically 3. Open in graphics software (Inkscape, Adobe Illustrator) or browsers 4. Adjust colors, labels, or layout as needed 5. Use in presentations, publications, or reports
**1. Sequence Exploration and Analysis** - Explore genomic sequences interactively - Identify sequence patterns and motifs - Analyze sequence composition - Study sequence organization
**2. Gene Structure Visualization** - View gene architecture (exons, introns, UTRs) - Understand gene organization - Analyze alternative splicing patterns - Study gene boundaries and regulatory regions
**3. Variant Visualization** - Visualize single nucleotide variants (SNVs) - Display insertions and deletions (indels) - Analyze structural variants - Study variant distribution and density
**4. Annotation Review** - Review and validate genomic annotations - Compare predicted vs. known features - Analyze annotation accuracy - Identify annotation conflicts or gaps
**5. Educational and Training** - Teach genomics and sequence analysis - Demonstrate sequence concepts - Visualize molecular biology concepts - Create educational materials
**6. Research Communication** - Create figures for publications - Prepare presentation graphics - Document genomic findings - Share visualizations with collaborators
**7. Quality Control** - Verify sequence integrity - Check for sequencing artifacts - Identify problematic regions - Validate sequence assembly
**8. Comparative Genomics** - Compare sequences from different sources - Analyze sequence conservation - Study evolutionary relationships - Identify unique or shared features
1. **Optimal viewing:** - Use zoom to focus on regions of interest - Zoom in to see individual nucleotides - Zoom out to see overall sequence structure - Adjust zoom level based on analysis needs
2. **Navigation strategies:** - Use "Jump to position" for quick navigation to specific coordinates - Use pan controls for continuous exploration - Drag to pan for smooth navigation - Use reset to return to full sequence view
3. **Annotation management:** - Toggle annotations on/off to reduce visual clutter - Focus on specific feature types by filtering - Use color coding to distinguish feature types - Check annotation coordinates for accuracy
4. **Sequence quality:** - Ensure sequences are correctly oriented - Check for sequencing errors or ambiguities - Verify sequence completeness - Use high-quality, validated sequences
5. **Visualization best practices:** - Adjust zoom level to show appropriate detail - Use coordinate ruler for position reference - Enable annotations for context - Export high-quality graphics for presentations
6. **Performance optimization:** - For very long sequences (>10,000 bp), focus on specific regions - Reduce number of annotations for better performance - Use region start/end parameters to limit view - Close annotation tracks when not needed
7. **Export guidelines:** - Export SVG for publications (scalable, high quality) - Adjust zoom level before exporting - Ensure annotations are visible if needed - Consider sequence length for export file size
8. **Annotation data:** - Use consistent coordinate systems (1-based) - Ensure annotation coordinates are within sequence bounds - Use descriptive feature names - Include feature types for proper color coding - Provide descriptions for context
9. **Integration with other tools:** - Use ORF Finder to identify potential genes - Combine with Primer Design for amplification planning - Integrate with Variant Calling for variant visualization - Use with alignment tools for comparative analysis
10. **Troubleshooting:** - If visualization is slow: Reduce sequence length or number of annotations - If annotations don't appear: Check coordinate ranges and format - If zoom doesn't work: Refresh page and try again - If export fails: Ensure browser allows downloads