Motif Finder identifies short, conserved sequence patterns (motifs) in DNA or RNA sequences. Motifs are critical for:
- **Regulatory elements**: Transcription factor binding sites, enhancers - **Functional sites**: Splicing sites, polyadenylation signals - **Protein binding**: RNA-protein interaction sites - **Evolutionary conservation**: Highly conserved functional elements
Motif characteristics
- Typically 5-20 nucleotides in length - Highly conserved across related sequences - Functionally important regions
Required
- FASTA format with multiple sequences - Sequences should contain the motif of interest - DNA or RNA sequences
Example input
``` >gene1 ATGCGATCGATCGATCGATCG >gene2 ATGCGATCGATCGATCGATCA >gene3 ATGCGATCGATCGATCGATCG ```
Sequence requirements
- Multiple sequences improve motif detection - Sequences should be related (contain similar motifs) - Minimum 3-5 sequences recommended
Motif Results
- **Consensus Motif**: Most common pattern across sequences - **Motif Positions**: Location of motifs in each sequence - **Motif Score**: Strength/conservation of the motif - **Frequency**: How often the motif appears
Motif Representation
- Consensus sequence showing most common nucleotide at each position - Position weight matrix (PWM) showing nucleotide probabilities - Sequence logo visualization (if available)
**1. Regulatory Element Discovery** - Find transcription factor binding sites - Identify promoter elements - Discover enhancer sequences
**2. Functional Annotation** - Identify splice sites - Find polyadenylation signals - Locate RNA processing sites
**3. Comparative Genomics** - Identify conserved regulatory elements - Study regulatory evolution - Compare regulatory networks
1. **Sequence selection**: Use sequences known or suspected to contain the motif 2. **Multiple sequences**: More sequences improve motif detection reliability 3. **Sequence length**: Ensure sequences are long enough to contain context 4. **Background sequences**: Compare against control sequences when possible 5. **Validation**: Validate identified motifs experimentally or with known databases